Antagonizing Deactivating Cytokines To Enhance Host Defense and Chemotherapy in Experimental Visceral Leishmaniasis
http://www.100md.com
感染与免疫杂志 2005年第7期
Departments of Medicine Microbiology and Immunology, Weill Medical College of Cornell University, New York, New York 10021
Laboratory of Cell Regulation and Carcinogenesis, National Cancer Institute, Bethesda, Maryland 20892
Wyeth Research, Cambridge, Massachusetts 02140
Biogen Idec, Cambridge, Massachusetts 02142
ABSTRACT
In experimental visceral leishmaniasis, inhibition of interleukin 10 (IL-10) signaling enhances Th1-cell-associated responses, promoting gamma interferon (IFN-) secretion, granuloma assembly, macrophage activation with substantial liver parasite killing, and synergy with pentavalent antimony (Sb) chemotherapy. To determine if inhibiting other suppressive cytokines has similar therapeutic potential, Leishmania donovani-infected BALB/c mice were injected with anti-IL-4 monoclonal antibody or receptor fusion antagonists of IL-13 or transforming growth factor (TGF-). Targeting IL-13 or TGF- enabled inhibition of L. donovani replication but little parasite killing; anti-IL-4 had no effect. None of the three antagonists promoted IFN- production, granuloma maturation, or Sb efficacy. Excess IL-13 and TGF- exacerbated liver infection; however, effects were transient. Among IL-10, IL-4, IL-13, and TGF-, cytokines capable of disabling Th1-cell mechanisms (including those which support chemotherapy), IL-10 appears to be the appropriate target for therapeutic inhibition in visceral L. donovani infection.
INTRODUCTION
In visceral leishmaniasis, a disseminated protozoal infection, resident macrophages in liver, spleen, and bone marrow are preferentially targeted and support parasite replication. In the susceptible host, intracellular infection progresses until chemotherapy is given or, alternatively, a T-cell-dependent response emerges to induce acquired resistance (43). In experimental Leishmania donovani infection in susceptible mice, acquired resistance in the liver is initially regulated by multiple Th1- and Th2-cell-associated cytokines (11, 41, 43, 54, 57, 59). However, the mechanism is primarily driven to completion by Th1-type products, including interleukin 12 (IL-12) and IL-12-induced gamma interferon (IFN-), acting in concert with tumor necrosis factor (TNF) (11, 41-43, 54, 59). If unimpeded, the net result at infected liver foci is the assembly of epitheloid granulomas within which intracellular parasites are killed by IFN-- and TNF-activated macrophages (44).
This same inflammatory mechanism also supports the efficacy of conventional antileishmanial chemotherapy—T cells and endogenous IL-12 and IFN- are required for expression of the visceral leishmanicidal action of pentavalent antimony (Sb) in experimental infection (12, 40, 41). As judged by results with additional cytokine gene-disrupted mice, TNF and IL-4 also optimize the host response to Sb (2, 42). The role of IL-4, ordinarily considered a suppression-type cytokine, appears to reflect its less-well-appreciated capacity to foster Th1-cell development and help regulate initial IFN- secretion (2, 57).
Efforts to take advantage of the preceding immunopharmacology have focused on IL-12 and IFN- and on raising the level of T-cell reactivity at the time of Sb treatment. Approaches in visceral infection have included coadministration of Sb (i) with exogenous IL-12 or IFN- (37, 41) or (ii) with induction of endogenous IL-12 and/or IFN- achieved by T-cell costimulation (46, 63), transfer of sensitized dendritic cells (16), or injection of IL-12 to induce endogenous IFN- (41). These experimental approaches enhance Sb's initial efficacy and/or the durability of its effect.
A separate immunochemotherapeutic strategy—inhibition of cytokines which deactivate the Th1-cell mechanism—has thus far been directed at two endogenous Th2-cell-type products, IL-4 and IL-10. In wild-type (WT) BALB/c mice with cutaneous Leishmania major infection, anti-IL-4 monoclonal antibody (MAb) injections restored the durability of the response to Sb by allowing Th1-cell-type responses to emerge (49). In WT BALB/c mice infected with visceral L. donovani, IL-4 is also induced (30) but IL-10 plays the primary deactivating role (35, 45). In these animals, IL-10 receptor (IL-10R) blockade by anti-IL-10R MAb injection enhanced Th1-cell-type responses and granuloma maturation, induced IFN--dependent parasite killing in the liver, and synergistically increased Sb's leishmanicidal effect (45, 47).
Like IL-10 and IL-4, IL-13 and transforming growth factor (TGF-) are also generated in experimental and human visceral, as well as cutaneous, leishmaniasis (4-6, 14, 15, 17, 20, 24, 25, 28-30, 33, 35, 43, 44, 49, 58, 60). While TGF- and IL-13 induce certain immunoactivating effects (9, 18), both are also capable of deactivating Th1-cell and/or inflammatory macrophage responses and promoting intracellular Leishmania infection (5, 9, 10, 17, 24, 25, 52, 60). Therefore, in this study, we asked whether endogenous TGF- and IL-13 or perhaps IL-4 (39) also represent targets worth inhibiting in L. donovani-infected mice to strengthen host defense and/or enhance chemotherapy efficacy. Animals with established visceral infection were injected with antagonists of TGF-, IL-13, or IL-4 alone and in combination with Sb to determine if this immunotherapeutic approach can be extended beyond endogenous IL-10 (45, 47).
MATERIALS AND METHODS
Animals. Female BALB/c mice (each, 20 to 30 g) were purchased from Charles Rivers Laboratories (Wilmington, MA). IL-13R2–/– mice on a BALB/c back-ground were produced at Wyeth Research (Andover, MA) (62) and bred at Weill Medical College (New York, NY). These latter mice (females) were 6 to 11 weeks old when challenged with L. donovani. These studies were reviewed and approved by the Institutional Animal Care and Use Committee of Weill Medical College.
Visceral infection and tissue granuloma responses. Groups of three to five mice were injected via the tail vein with 1.5 x 107 hamster spleen-derived L. donovani amastigotes (1 Sudan strain) (45). Visceral infection was assessed microscopically by using Giemsa-stained liver imprints in which liver parasite burdens were measured by blinded counting of the number of amastigotes per 500 cell nuclei x liver weight in milligrams (Leishman-Donovan units [LDU]) (45). The histological response to infection was evaluated microscopically in liver sections stained with hematoxylin and eosin. The number of granulomas (infected Kupffer cells which attracted five or more mononuclear cells (45) was counted in 100 consecutive 40x fields and, at 100 parasitized foci, the granulomatous reaction was scored as none, developing, or mature (45). Mature granulomas consisted of a core of fused parasitized Kupffer cells surrounded by numerous mononuclear cells and showed epitheloid-type changes (44).
Anticytokine treatments. Cytokine antagonists were administered by intraperitoneal injection in 0.5 ml of saline starting 12 days after infection (day + 12). All mice were sacrificed 9 days later on day + 21. Day + 21 liver parasite burdens (LDU) were compared to day + 12 LDU to determine the percentage of parasite killing (45); differences between mean LDU values were analyzed by a two-tailed Student's t test.
For IL-10R blockade or IL-4 neutralization, the following were injected once on day + 12: (i) 0.5 mg of rat immunoglobulin G (IgG) or anti-IL-10R MAb (1B1.3A; provided by A. Beebe, DNAX Research Institute of Molecular and Cellular Biology, Palo Alto, CA) (45) or (ii) 5 mg of rat IgG or anti-IL-4 MAb (11.B.11; provided by C. Reynolds, Biologic Response Modifers Program, National Cancer Institute, Frederick, MD) (30). For IL-13 inhibition, 0.2 mg of soluble IL-13 receptor-2-IgG-Fc (IL-13R2-Fc) (Wyeth Research) or human IgG (Wyeth Research) was injected every second day as in previous studies (8) and was given on days + 12, + 14, + 16, and + 18. Soluble chimeric TGF- type II receptor-IgG-Fc (TGF-RII-Fc) (Biogen Idec, Cambridge, MA) was used to inhibit TGF- (34). Preliminary dose-response experiments (not shown) using a single injection on day + 12 of 1 to 10 mg/kg of body weight (25 to 250 μg) of TGF-RII-Fc indicated no effect on day + 21 for 1 mg/kg and maximal effects at 4 mg/kg (100 μg). The latter dose was used with infected mice and was given once on day + 12; controls received 4 mg/kg of mouse IgG2a (Biogen).
TGF- treatment. Starting one day after L. donovani challenge, mice were injected intraperitoneally thrice weekly for 4 weeks with 0.5 ml of saline alone or saline containing 5 μg of recombinant human TGF- (5). Cytokine was generously provided by S. Reed (Corixa Corporation, Seattle, WA).
Chemotherapy. To demonstrate the effect of combination treatment, cytokine antagonist-treated and control IgG-treated mice were injected once on day + 14 with suboptimal-dose pentavalent antimony (Sb) (50 mg/kg of sodium stibogluconate [Pentostam]; Wellcome Foundation, Ltd., London, United Kingdom) (45). Based upon prior results (45, 47), suboptimal anti-IL-10R (0.1 mg) was used in these experiments, whereas the other cytokine antagonists were used as described above. Optimal-dose Sb was tested in IL-13R2–/– and TGF--treated WT mice by injecting 500 mg/kg once on day + 14 (45).
TGF- and IL-13 expression in liver tissue and serum IFN- assay. TGF-1 and IL-13 mRNA expression was detected in liver lysates by semiquantitative reverse transcription-PCR (RT-PCR). The primers used for PCR were as follows: (i) for TGF-1, AGCCCGAAGCGGACTACTAT (sense) and TCCACATGTTGCTCCACACT (antisense); (ii) for IL-13, AGGAGCTGAGCAACATCACA (sense) and GTGGGCTACTTCGATTTTGG (antisense); and (iii) for hypoxanthine phosphoribosyltransferase, GTTGGATACAGGCCAGACTTTGTTG (sense) and GAGGGTAGGCTGGCCTATGGCT (antisense). The PCR products were analyzed by gel electrophoresis, quantified using Quantity One 4.4.1 (Bio-Rad, Hercules, CA), and normalized to hypoxanthine phosphoribosyltransferase for equal loading. Immunolocalization of intracellular TGF-1 protein was carried out as previously described (13) with liver sections and the polyclonal antibody LC 1-30-1 (6 μg/ml). Serum was assayed in duplicate at fourfold dilutions for IFN- activity by a murine IFN- enzyme-linked immunosorbent assay (BD-Pharmingen, set no. 555138) in which the lower limit of detection was 31 pg/ml.
RESULTS
IL-10R blockade in established infection. To provide a benchmark against which to compare the effects of antagonizing IL-4, TGF-, and IL-13, WT BALB/c mice were injected once with anti-IL-10R MAb on day + 12 after infection. As shown in Tables 1 and 2, anti-IL-10R induced liver parasite killing (63%) and at low doses enhanced the effect of suboptimal Sb, confirming the deactivating role of IL-10 in this model (45, 47). These effects were accompanied by elevated serum IFN- levels (Fig. 1) and a clear increase in liver granulomas scored as mature (68% ± 6% versus 18% ± 5% in control IgG-treated mice; P < 0.05, two experiments). Figure 2 illustrates the histological response on day + 21. Anti-IL-10R-induced parasite killing and synergy with Sb require IFN-; effects on granuloma assembly involve both IFN--dependent and -independent pathways (45).
Effect of anti-IL-4 MAb. In addition to IL-10 mRNA, L. donovani-infected WT BALB/c mice also initially express IL-4 mRNA in parasitized liver and/or spleen (28, 30, 34). However, injection of anti-IL-4 MAb on day + 12 produced no therapeutic action on day + 21 (Tables 1 and 2), did not affect granuloma maturation, and decreased serum IFN- levels (Fig. 1), although not signficantly (P > 0.05). Once-weekly injections of 5 mg of anti-IL-4 starting 1 day after L. donovani challenge also induced no antileishmanial activity on day + 21 or + 28 and did not enhance the efficacy of suboptimal Sb (50 mg/kg) given on day + 14. At the same time, this weekly anti-IL-4 treatment also did not promote parasite replication in WT mice or impair the response to Sb (50 or 500 mg/kg injected on day + 14) (two experiments; data not shown), effects reported with L. donovani-infected mice genetically deficient in IL-4 (57).
Detection of TGF- and effect of soluble TGF-RII-Fc. TGF-1 mRNA was detected by RT-PCR in livers of infected BALB/c mice (Fig. 3A); by day + 28, however, expression was not significantly different versus constitutive levels at day 0 in uninfected livers. Since TGF- mRNA expression may not correlate with protein production (29), tissue sections were stained for immunoreactive cytokine using an antibody which detects TGF-1 in active and latent form (13). In livers of uninfected mice, cell-associated reaction product was readily apparent and expressed within 75% of hepatocytes (Fig. 4A). In infected livers, results were clearly different: few parenchymal cells showed immunoreactive TGF-1 at either day + 14 (Fig. 4B) or day + 21 (not shown). In addition, within developing granulomas that encircle parasitized macrophages (Kupffer cells) (5, 52), few cells showed visible TGF- reaction product (Fig. 4B). Despite the preceding results, treatment with TGF-IIR-Fc, which interferes with cytokine-receptor binding and inhibits TGF- effects (34), altered the kinetics of L. donovani replication in WT mice. While a single injection of TGF-IIR-Fc on day + 12 primarily enabled inhibition of parasite replication, some parasite killing (14%) was also induced at day + 21 (Table 1). Administering an additional dose of TGF-IIR-Fc on either day + 14, +16, or + 18 did not further enhance the effect. Although endogenous TGF- appeared to actively promote infection, the antileishmanial effect of TGF-IIR-Fc was not sufficient to augment the action of low-dose Sb (Table 2) or to materially increase serum IFN- or granuloma maturation (Fig. 1 and 2).
Detection of IL-13 and response to soluble IL-13R2-Fc. L. donovani infection also stimulated IL-13 mRNA expression in livers of WT BALB/c mice (Fig. 3B), prompting the testing of IL-13R2-Fc, which inhibits IL-13-induced effects (8). Injections of IL-13R2-Fc on day + 12 or on days + 12 and + 14 produced no effect. However, four alternate-day treatments during days + 12 to + 18 clearly inhibited parasite replication (Table 1) and produced some enhancing effect on granuloma cellularity (Fig. 2F). Nevertheless, IL-13R2-Fc treatment did not promote Sb's efficacy (Table 2), alter serum IFN- (Fig. 1), or significantly increase mature granuloma numbers in the liver (not shown).
Effect of raising the levels of IL-13 or TGF-. The preceding results indicated a regulatory role for endogenous TGF- and IL-13, albeit limited, but none for IL-4. These findings were generated in the presence of counterbalancing and IL-12- and IFN--mediated Th1-type responses, which are also expressed in BALB/c mice by the second week of infection (30, 45). Thus, the observations did not exclude the possibility that IL-13 or TGF- might act in a more suppressive fashion under different conditions. For example, although anti-IL-4 has no effect in this L. donovani model (30), administration of IL-4 or manipulation that provokes endogenous IL-4 readily enhances visceral parasite replication in these same BALB/c mice (39). Therefore, to complete this analysis, we examined the consequences of raising IL-13 or TGF- levels rather than inhibiting their effects.
In the absence of the decoy function of IL-13R2, IL-13R2–/– mice show high IL-13 levels in the tissues including liver (62) and in this way are thought to phenotypically resemble IL-13 transgenic mice (26). The following results were observed with IL-13R2–/– versus WT BALB/c mice, respectively. (i) Serum IFN- was reduced at day + 14 (76 ± 23 versus 205 ± 34 pg/ml, six to seven mice per group; P > 0.05) and day + 21 (72 ± 18 versus 351 ± 53 pg/ml, six to eight mice per group; P < 0.05). (ii) Initial granuloma assembly and maturation were impaired (Fig. 5). (c) Liver parasite burdens were increased (Fig. 6A). These findings are consistent with a suppressive effect for IL-13. However, deficient tissue inflammation and susceptibility were not sustained in IL-13R2–/– mice, as after week 4, the granulomatous response evolved and liver burdens declined by 60% (Fig. 6A). IL-13Ra2–/– mice also demonstrated an intact response to optimal-dose Sb (500 mg/kg injected once on day + 14) with 88% killing of liver amastigotes by day + 21 versus 93% in WT controls; responses to suboptimal Sb (single injections of 50 or 100 mg/kg) were preserved as well (two experiments).
Raising the level of TGF- by injecting WT BALB/c mice with high-dose human TGF- also increased susceptibility but in a similarly transient fashion. Thrice-weekly treatment starting 1 day after infection with the same cytokine preparation that promoted L. braziliensis infection (5) increased liver parasite burdens on day + 14, but continued injections did not maintain the effect (Fig. 6B). In these same mice, exogenous TGF- did not impair either the liver granulomatous response (not shown) or affect the efficacy of optimal-dose (86% killing) or suboptimal-dose Sb given on day + 14 (two experiments).
DISCUSSION
In the spectrum of experimental leishmaniasis, IL-10, IL-4, IL-13, and TGF- are generally but not invariably (22, 31, 57) recognized for derailing Th1-cell-associated mechanisms and deactivating macrophages, thereby dampening inflammation but fostering progressive intracellular infection (17-19, 24, 25, 32, 35, 39, 45, 49, 51, 52, 60). In the L. donovani model, results with IL-10 transgenic and -deficient mice have already assigned such a role to IL-10 (35, 45). However, other suppressive-type cytokines, acting alone, with IL-10 or via crossregulation (4, 28, 29, 33, 39, 51, 55, 59, 60) may also promote visceral infection and therefore represent separate potential targets for therapeutic inhibition. Such inhibition, which can raise the level of Th1-cell reactivity and strengthen host defense in general (1, 24, 32, 35, 43, 45, 47, 49, 51, 52) can also specifically enhance chemotherapy efficacy. In addition to combining Sb or amphotericin B with targeting IL-10 in L. donovani infection (45, 47, 48), this anticytokine strategy has also been successfully directed at IL-4 in cutaneous L. major infection (anti-IL-4 MAb plus Sb) (49) and in systemic Candida albicans infection (antagonistic soluble IL-4 receptor plus antifungal agents) (7).
BALB/c mice express multiple deactivating cytokines in response to L. donovani (28, 30, 33), and our results indicate regulatory (suppressive) roles for both endogenous TGF- and IL-13. That endogenous IL-4 is expressed but does not exert a measurable effect in L. donovani-infected WT mice has also been made clear in previous studies (22, 27, 28). The effects of inhibiting endogenous TGF- or IL-13 in the midst of progressive infection were modest and limited primarily to induction of leishmanistatic activity. In contrast, anti-IL-10R treatment stimulated IFN- secretion and granuloma maturation, induced high-level parasite killing in the liver, and supported the efficacy of chemotherapy. These effects were not detected in mice treated with TGF-RII-Fc or IL-132R-Fc (or anti-IL-4), emphasizing in a comparative fashion IL-10's prominent handcuffing effect in visceral infection (35, 45, 47).
Since there may be organ-specific responses in the L. donovani model (11, 36), cytokine inhibition might produce different effects on infection in spleen or bone marrow. In addition, we have not yet examined how targeting IL-13 or TGF- enables inhibition of parasite replication, although in view of the intracellular location of L. donovani, enhancing effects on macrophage activation seem likely. Given our objective—a practical therapeutic strategy for use alone or in combination with chemotherapy in established infection (e.g., a single injection of anti-IL-10R (45, 47, 48)—these experiments were intended to determine effects of acute rather than chronic cytokine inhibition. Thus, it also remains possible that for TGF- and IL-13 (but not IL-4) inhibition, more time is required for the expression of additional antileishmanial effects. However, we tested chronic TGF- antagonism in one experiment by injecting TGF-RII-Fc (4 mg/kg) thrice weekly, starting 1 day after infection. In mice treated for 4 weeks, liver parasite replication was inhibited but still proceeded, granuloma formation was unaffected at weeks 2 and 4, and the effect of suboptimal Sb injected on day + 14 was not increased on day + 21 (four mice; data not shown).
The limited effects of inhibiting endogenous TGF- as well as IL-13 in WT mice might also reflect other factors. Both cytokines may preferentially target an auxillary (leishmanistatic) rather than a primary killing mechanism, and such a secondary mechanism might also not be involved in supporting Sb's leishmanicidal efficacy. For example, neither antagonist of TGF- or IL-13 provoked IFN-, the cytokine required for L. donovani killing, as well as the key endogenous cofactor in the host response to Sb (40, 43). IL-10-induced deactivation in this model may also be sufficient to mask competing, suppressive effects stimulated by IL-13 or TGF-; future experiments will test the effect of simultaneously inhibiting IL-10, TGF-, and/or IL-13.
Three additional observations are also worth comment. First, like IL-10 (32), endogenous IL-4 and IL-13 can also suppress Th1-cell-type mechanisms, indirectly and/or directly deactivate macrophages, and therefore foster intracellular Leishmania infection (9, 25, 35, 37, 47, 49, 50, 51, 53). However, neither IL-4 nor IL-13 plays a consistently suppressive role; their effects appear model and/or Leishmania species dependent (22, 23, 27, 30, 31, 49, 53, 56, 57). Adding to this complexity, IL-4 and IL-13 can also act to support host defenses. Results with L. donovani-infected IL-4–/– and IL-4R–/– mice indicate roles in initial Th1-cell development, IFN- regulation, and control of early L. donovani replication (27, 57), and for IL-4, in responsiveness to Sb treatment (2). In our experiments, these IL-4-associated effects were not apparent under the quite different conditions of treating WT mice once weekly with anti-IL-4 MAb starting 1 day after infection. In a separate setting, however, with WT BALB/c mice manipulated (immunized) to cross-react to L. donovani with a predominant Th2-type response, IL-4 readily emerges as a suppressive cofactor acting with IL-10 to impair granuloma assembly and induce the noncure phenotype (39).
Second, TGF-, which can produce upregulatory effects, is also fully capable of impairing Th1-cell responses and macrophage activation (10, 18). In experimental Leishmania infection, exogenous TGF- promotes cutaneous as well as visceral parasite replication (5, 60) (Fig. 6B) and, in endogenous form, stimulates initial progression or subsequent persistence of cutaneous infection (3, 24, 52). Inferential results also suggest that endogenous TGF- fosters the visceral replication of L. chagasi (14) and persistence of L. infantum (17); our findings with L. donovani-infected, TGF-RII-Fc-treated mice support such a role in vivo.
Nevertheless, in most but not all (28) models of visceral infection in WT mice, TGF- activity either does not increase during the initial period in which liver parasite replication is unrestrained (33, 61, 63) or increases but then decreases at the peak of hepatic infection (17). These results, reflected in in vitro and in vivo TGF- protein production (Fig. 4) (17, 61, 63) and in in vivo mRNA expression (Fig. 3A) (33), may help to explain the comparatively limited effect of TGF-RII-Fc treatment given during week 2 (Tables 1 and 2). However, TGF- activity can also reemerge or increase at a later stage of infection (28, 33, 61) and might take on other roles: curtailing the inflammatory response after liver infection is largely controlled, regulating conversion of residual liver infection to a chronic, persistent state (3, 17), or fostering the delayed but progressive infection in the spleen reported in some models of visceral infection (21, 33).
Finally and third, the intact response to Sb in the presence of excess IL-13 or TGF- adds to prior observations indicating that suppression-type cytokines do not impair the initial in vivo response to chemotherapy (45, 49). Optimal-dose Sb (500 mg/kg) is also fully active against L. donovani in the face of either sustained IL-10 in transgenic BALB/c mice (45) or raised levels of both IL-4 and IL-10 in heat-killed L. major-immunized BALB/c mice (39). In both of these latter noncuring groups of mice, as well as in IL-4 transgenic, IL-13R2–/–, and TGF--treated animals, an injection of 500 mg/kg of Sb on day + 14 is as active as in control mice, killing 90% of liver L. donovani by day + 21 (39, 45; the present report and unpublished data). Thus, although the leishmanicidal efficacy of Sb in the liver is dependent upon and can be amplified by the host Th1-cell-type response (12, 16, 37-41, 46, 47, 63), this particular IFN-- and IL-12-mediated Th1-cell action paradoxically escapes the deactivating effects of IL-10, IL-4, IL-13, or TGF-. Conversely, however, only inhibition of IL-10 synergistically enhanced the effect of Sb in this comparative analysis, strengthening the appeal of IL-10 as the appropriate cytokine target for therapeutic inhibition in experimental visceral infection.
ACKNOWLEDGMENTS
This work was supported by NIH grants AI 16369 (H.W.M.) and AI 45899 (X.M.).
Elaine Brooks and Christine Tsai provided expert technical assistance.
REFERENCES
1. Akhurst, R. J. 2002. TGF- antagonists: why suppress a tumor suppressor J. Clin. Investig. 109:1533-1536.
2. Alexander, J., K. C. Carter, N. Al-Fasi, A. Satoskar, and F. Brombacher. 2000. Endogenous IL-4 is necessary for effective drug therapy against visceral leishmaniasis. Eur. J. Immunol. 30:2935-2943.
3. Alexander, J. F. Brombacher, H. A. McGachy, A. N. McKenzie, W. Walker, and K. C. Carter. 2002. An essential role for IL-13 in maintaining a non-healing response following Leishmania mexicana infection. Eur. J. Immunol. 32:2923-2933.
4. Babaloo, Z., P. M. Kaye, and M. B. Eslami. 2001. Interleukin-13 in Iranian patients with visceral leishmaniaisis: relationship to other Th2 and Th1 cytokines. Trans. R. Soc. Trop. Med. Hyg. 95:85-88.
5. Barral-Netto, M., A. Barral, C. E. Brownell, Y. A. W. Skeiky, L. R. Ellingsworth, D. R. Twardzik, and S. G. Reed. 1992. Transforming growth factor- in leishmanial infection: a parasite escape mechanism. Science 257:545-548.
6. Bourreau, E., G. Prevot, R. Pradinaud, and P. Lainois. 2001. Interleukin (IL)-13 is the predominant Th2 cytokine in localized cutaneous leishmaniasis lesions and renders specific CD4+ T cells unresponsive to IL-12. J. Infect. Dis. 183:953-959.
7. Cenci, E., A. Mencacci, G. Del Sero, F. Bistoni, and L. Romani. 1997. Induction of protective Th1 responses to Candida albicans by antifungal therapy alone or in combination with an interleukin-4 antagonist. J. Infect. Dis. 176:217-226.
8. Chiaramonte, M. G., D. D. Donaldson, A. W. Cheever, and T. A. Wynn. 1999. An IL-13 inhibitor blocks the development of hepatic fibrosis during a T-helper type 2-dominated inflammatory response. J. Clin. Investig. 104:777-785.
9. deVries, J. E. 1998. The role of IL-13 and its receptor in allergy and inflammatory responses. J. Allergy Clin. Immunol. 102:165-169.
10. Ding, A., C. F. Nathan, J. Graycar, R. Derynck, D. J. Stuehr, and S. Srimal. 1990. Macrophage deactivating factor and transforming growth factors-1, -2 and -3 inhibit induction of macrophage nitrogen oxide synthesis by IFN-. J. Immunol. 145:940-944.
11. Engwerda, C. R., M. L. Murphy, S. E. Cotterell, S. C. Smelt, and P. M. Kaye. 1998. Neutralization of IL-12 demonstrates the existence of discrete organ-specific phases in the control of Leishmania donovani. Eur. J. Immunol. 28:669-680.
12. Escobar, P., V. Yardley, and S. L. Croft. 2001. Activities of hexadecylphosphocholine (miltefosine), AmBisome, and sodium stibogluconate (Pentostam) against Leishmania donovani in immunodeficient scid mice. Antimicrob. Agents Chemother. 45:1872-1875.
13. Flanders, K. C., C. D. Sullivan, M. Fujii, A. Sowers, M. A. Anzano, A. Arabshahi, C. Major, J. B. Mitchell, and A. B. Roberts. 2002. Mice lacking Smad3 are protected against cutaneous injury induced by ionizing radiation. Am. J. Pathol. 160:1057-1068.
14. Gantt, K. R., S. Schulz-Cherry, N. Rodriguez, S. M. B. Jeronimo, E. T. Nascimento, T. L. Goldman, T. J. Recker, M. A. Miller, and M. E. Wilson. 2003. Activation of TGF- by Leishmania chagasi: importance for parasite survival in macrophages. J. Immunol. 170:2613-2620.
15. Gassim, S., A. M. El-Hassan, E. A. G. Khalil, A. Ismail, A. M. Y. Kadarn, A. Kharazmi, and T. G. Theander. 1998. High levels of plasma IL-10 and expression of IL-10 by keratinocytes during visceral leishmaniasis predict subsequent development of post-kala-azar dermal leishmaniasis. Clin. Exp. Immunol. 111:64-69.
16. Ghosh, M., C. Pal, M. Ray, S. Maitra, L. Mandal, and S. Bandyopadhyay. 2003. Dendritic cell-based immunotherapy combined with antimony-based chemotherapy cures established murine visceral leishmaniasis. J. Immunol. 170:5625-5629.
17. Gomes-Pereira, S., O. R. Rodrigues, N. Rolao, P. D. Almeida, and G. M. Santos-Gomes. 2004. Hepatic cellular immune responses in mice with "cure" and "non-cure" phenotype to Leishmania infantum infection: importance of CD8+ T cells and TGF- production. FEMS Immun. Med. Microbiol. 41:59-68.
18. Gorelik, L., and R. A. Flavell. 2002. Transforming growth factor- in T cell biology. Nat. Rev. Immunol. 2:46-53.
19. Jones, D. E., L. U. Buxbaum, and P. Scott. 2000. IL-4-independent inhibition of IL-12 responsiveness during Leishmania amazonensis infection. J. Immunol. 165:364-372.
20. Karp, C. L., S. H. El-Safi, T. A. Wynn, M. M. H. Satti, A. N. Kordofani, F. A. Hashim, M. Hag-Ali, F. A. Neva, T. B. Nutman, and D. L. Sacks. 1993. In vivo cytokine profiles in patients with kala-azar. Marked elevation of both interleukin-10 and interferon-gamma. J. Clin. Investig. 91:1644-1648.
21. Kaye, P. M., M. Svensson, M. Ato, A. Maroof, R. Polley, S. Stager, S. Zubairi, and C. R. Engwerda. 2004. The immunopathology of experimental visceral leishmaniasis. Immunol. Rev. 201:239-253.
22. Kropf P., L. R. Schopf, C. L. Chung, D. Xu, F. Y. Liew, J. P. Sypek, and I. Muller. 1999. Expression of Th2 cytokines and the stable Th2 marker ST2L in the absence of IL-4 during Leishmania major infection. Eur. J. Immunol. 29:3621-3628.
23. Lehmann, J., K-H. Ensle, I. Lehmann, A. Emmendorfer, and M-L. Lohmann-Mattes. 2000. The capacity to produce IFN- rather than the presence of interleukin 4 determines the resistance and the degree of susceptibility to Leishmania donovani infection in mice. J. Interferon Cytokine Res. 20:63-77.
24. Li, J., C. A. Hunter, and J. P. Farrell. 1999. Anti-TGF- treatment promotes rapid healing of Leishmania major infection in mice by enhancing in vivo nitric oxide production. J. Immunol. 162:974-979.
25. Matthews, D. J., C. L. Emson, G. J. McKenzie, H. E. Jolin, J. M. Blackwell, and A. N. J. McKenzie. 2000. IL-13 is a susceptibility factor for Leishmania major infection. J. Immunol. 164:1458-1462.
26. McKenzie, A. N. J., and P. G. Fallon. 2003. Decoy receptors in the regulation of T helper cell type 2 responses. J. Exp. Med. 197:675-679.
27. McMahon-Pratt, D., and J. Alexander. 2004. Does the Leishmania major paradigm of pathogenesis and protection hold for New World cutaneous leishmaniases or the visceral disease Immunol. Rev. 201:206-224.
28. Melby, P. C., A. Tabares, B. I. Restrepo, A. E. Cardona, H. S. McGruff, and J. M. Teale. 2001. Leishmania donovani: evolution and architecture of the splenic cellular immune response related to control of infection. Exp. Parasitol. 99:17-25.
29. Melby, P. C., B. Chandrasekar, W. Zhao, and J. E. Coe. 2001. The hamster as a model of human visceral leishmaniasis: progressive disease and impaired generation of nitric oxide in the face of a prominent Th1-like cytokine response. J. Immunol. 166:1912-1920.
30. Miralles, G. D., M. Y. Stoeckle, D. F. McDermott, F. D. Finkelman, and H. W. Murray. 1994. Induction of Th1 and Th2 cell-associated cytokines in experimental visceral leishmaniasis. Infect. Immun. 62:1058-1063.
31. Mohrs, M., B. Ledermann, G. Kohler, A. Dorfmuller, A. Gessner., and F. Brombacher. 1999. Differences between IL-4- and IL-4-receptor -deficient mice in chronic leishmaniasis reveal a protective role for IL-13 receptor signaling. J. Immunol. 162:7302-7308.
32. Moore, K. W., R. de Waal Malefyt, R. L. Coffman, and A. O'Garra. 2001. Interleukin-10 and the interleukin-10 receptor. Annu. Rev. Immunol. 19:683-765.
33. Mukherjee, P., A. K. Ghosh, and A. C. Ghose. 2003. Infection pattern and immune response in the spleen and liver of BALB/c mice intracardially infected with Leishmania donovani amastigotes. Immunol. Lett. 86:131-138.
34. Muraoka, R. S., N. Dumont, C. A. Ritter, T. C. Dugger, D. M. Brantley, J. Chen, E. Easterly, L. R. Roebuck, S. Ryan, P. J. Gotwals, V. Koteliansky, and C. L. Arteaga. 2002. Blockade of TGF- inhibits mammary tumor cell viablity, migration, and metastases. J. Clin. Investig. 109:1551-1559.
35. Murphy, M. L., U. Wille, E. N. Villegas, C. A. Hunter, and J. P. Farrell. 2001. IL-10 mediates susceptibility to Leishmania donovani infection. Eur. J. Immunol. 31:2848-2856.
36. Murray, H. W., H. Masur, and J. S. Keithly. 1982. Cell-mediated immune response in experimental visceral leishmaniasis. I. Correlation between resistance to Leishmania donovani and lymphokine-generating capacity. J. Immunol. 129:344-350.
37. Murray, H. W., J. D. Berman, and S. D. Wright. 1988. Immunochemotherapy for intracellular Leishmania donovani infection: interferon-gamma plus pentavalent antimony. J. Infect. Dis. 157:973-978.
38. Murray, H. W., M. J. Oca, A, M. Granger, and R. D. Schreiber. 1989. Successful response to chemotherapy in experimental visceral leishmaniasis: requirement for T cells and effect of lymphokines. J. Clin. Investig. 83:1254-1259.
39. Murray, H. W., J. Hariprashad, and R. L. Coffman. 1997. Behavior of visceral Leishmania donovani in an experimentally-induced Th2 cell-associated response model. J. Exp. Med. 185:867-874.
40. Murray, H. W., and S. Delph-Etienne. 2000. Role of endogenous gamma interferon and macrophage microbicidal mechanisms in host response to chemotherapy in experimental visceral leishmaniasis. Infect. Immun. 68:288-293.
41. Murray, H. W., C. Montelibano, R. Peterson, J. P. Sypek. 2000. Interleukin 12 regulates the response to chemotherapy in experimental visceral leishmaniasis J. Infect. Dis. 182:1497-1503.
42. Murray, H. W., A. Jungbluth, E. Ritter, C. Montelibano, and M. W. Marino. 2000. Visceral leishmaniasis in mice devoid of tumor necrosis factor and response to treatment. Infect. Immun. 68:6289-6293.
43. Murray, H. W. 2001. Clinical and experimental advances in treatment in visceral leishmaniasis. Antimicrob. Agents Chemother. 45:2185-2197.
44. Murray, H. W. 2001. Tissue granuloma structure-function in experimental visceral leishmaniasis. Int. J. Exp. Pathol. 82:249-267.
45. Murray, H. W., C. M. Lu, S. Mauze, S. Freeman, A. L. Moreira, G. Kaplan, and R. L. Coffman. 2002. Interleukin-10 (IL-10) in experimental visceral leishmaniasis and IL-10 receptor blockade as immunotherapy. Infect. Immun. 70:6284-6293.
46. Murray, H. W., C. M. Lu, E. B. Brooks, R. E. Fichtl, J. L. DeVecchio, and F. P. Heinzel. 2003. Modulation of T-cell costimulation as immuno- or immunochemotherapy in experimental visceral leishmaniasis. Infect. Immun. 71:6453-6462.
47. Murray, H. W., A. L. Moreira, C. M. Lu, J. L. DeVecchio, M. Matsuhashi, X. Ma, and F. P. Heinzel. 2003. Determinants of response to interleukin 10 receptor blockade immunotherapy in experimental visceral leishmaniasis. J. Infect. Dis. 188:458-464.
48. Murray, H. W., E. B. Brooks, J. L. DeVecchio, and F. P. Heinzel. 2003. Immunoenhancement combined with amphotericin B as treatment in experimental visceral leishmaniasis. Antimicrob. Agents Chemother. 47:2513-2517.
49. Nabors, G. S. 1997. Modulating ongoing Th2-cell responses in experimental leishmaniasis. Parasitol. Today 13:76-79.
50. Noben-Trauth, N., R. Lira, H. Nagase, W. E. Paul, and D. L. Sacks. 2003. The relative contrtibution of IL-4 receptor signaling and IL-10 to susceptibility to Leishmania major. J. Immunol. 170:5152-5158.
51. Powrie, F., S. Menon, and R. L. Coffman. 1993. IL-4 and IL-10 synergize to inhibit cell-mediated immunity in vivo. Eur. J. Immunol. 23:2223-2229.
52. Reed, S. G. 1999. TGF- in infections and infectious diseases. Microbes Infect. 1:1313-1325.
53. Reiner, S. L., and R. M. Locksley. 1995. The regulation of immunity to Leishmania major. Annu. Rev. Immunol. 13:151-177.
54. Satoskar, A. R., S. Rodig, S. R. Telford, A. A. Satoskar, S. K. Ghosh, F. von Lichtenberg, and J. R. David. 2000. IL-12 gene-deficient C57BL/6 mice are susceptible to Leishmania donovani but have diminshed hepatic pathology. Eur. J. Immunol. 30:834-839.
55. Schmidt-Weber, C. B., and K. Blaser. 2004. Regulation and role of transforming growth factor- in immune tolerance induction and inflammation. Curr. Opin. Immunol. 16:709-716.
56. Sosa, M. R., L. E. Rosas, A. N. J. McKenzie, and A. R. Satoskar. 2001. IL-13 gene-deficient mice are susceptible to cutaneous Leishmania mexicana infection. Eur. J. Immunol. 31:3255-3260.
57. Stager, S., J. Alexander, K. C. Carter, F. Brombacher, and P. M. Kaye. 2003. Both interleukin-4 (IL-4) and IL-4 receptor signaling contribute to the development of hepatic granulomas with optimal antileishmanial activity. Infect. Immun. 71:4804-4807.
58. Sundar, S., S. G. Reed, S. Sharma, A. Mehrota, and H. W. Murray. 1997. Circulating Th1 cell- and Th2 cell-associated cytokines in Indian patients with visceral leishmaniasis. Am. J. Trop. Med. Hyg. 56:522-525.
59. Tumang, M. C. T., C. Keogh, L. L. Moldawer, D. C. Helfgott, R. Teitelbaum, J. Hariprashad, and H. W. Murray. 1994. Role and effect of TNF- in experimental visceral leishmaniasis. J. Immunol. 153:768-775.
60. Wilson, M. E., B. M. Young, B. L. Davidson, K. A. Mente, and S. E. McGowan. 1998. The importance of TGF- in murine visceral leishmaniasis. J. Immunol. 161:6148-6155.
61. Wilson, M. E., T. J. Recker, N. E. Rodriguez, B. M. Young, K. K. Burnell, J. A. Streit, and J. N. Kline. 2002. The TGF- response to Leishmania chagasi in the absence of IL-12. Eur. J. Immunol. 32:3556-3565.
62. Wood, N., M. J. Whitters, B. A. Jacobson, J. Witek, J. P. Sypek, M. Kasaian, M. J. Eppihimer, M. Unger, T. Tanaka, S. J. Goldman, M. Collins, D. D. Donaldson, and M. J. Grusby. 2003. Enhanced interleukin (IL)-13 responses in mice lacking IL-13 receptor 2. J. Exp. Med. 197:703-709.
63. Zubairi, S., S. L. Sanos, S. Hill, and P. M. Kaye. 2004. Immunotherapy with OX40L-Fc or anti-CTLA-4 enhances local tissue responses and killing of Leishmania donovani. Eur. J. Immunol. 34:1-8.(Henry W. Murray, Kathleen)
淇℃伅浠呬緵鍙傝€冿紝涓嶆瀯鎴愪换浣曚箣寤鸿銆佹帹鑽愭垨鎸囧紩銆傛枃绔犵増鏉冨睘浜庡師钁椾綔鏉冧汉锛岃嫢鎮ㄨ涓烘鏂囦笉瀹滆鏀跺綍渚涘ぇ瀹跺厤璐归槄璇伙紝璇烽偖浠舵垨鐢佃瘽閫氱煡鎴戜滑锛屾垜浠敹鍒伴€氱煡鍚庯紝浼氱珛鍗冲皢鎮ㄧ殑浣滃搧浠庢湰缃戠珯鍒犻櫎銆�Laboratory of Cell Regulation and Carcinogenesis, National Cancer Institute, Bethesda, Maryland 20892
Wyeth Research, Cambridge, Massachusetts 02140
Biogen Idec, Cambridge, Massachusetts 02142
ABSTRACT
In experimental visceral leishmaniasis, inhibition of interleukin 10 (IL-10) signaling enhances Th1-cell-associated responses, promoting gamma interferon (IFN-) secretion, granuloma assembly, macrophage activation with substantial liver parasite killing, and synergy with pentavalent antimony (Sb) chemotherapy. To determine if inhibiting other suppressive cytokines has similar therapeutic potential, Leishmania donovani-infected BALB/c mice were injected with anti-IL-4 monoclonal antibody or receptor fusion antagonists of IL-13 or transforming growth factor (TGF-). Targeting IL-13 or TGF- enabled inhibition of L. donovani replication but little parasite killing; anti-IL-4 had no effect. None of the three antagonists promoted IFN- production, granuloma maturation, or Sb efficacy. Excess IL-13 and TGF- exacerbated liver infection; however, effects were transient. Among IL-10, IL-4, IL-13, and TGF-, cytokines capable of disabling Th1-cell mechanisms (including those which support chemotherapy), IL-10 appears to be the appropriate target for therapeutic inhibition in visceral L. donovani infection.
INTRODUCTION
In visceral leishmaniasis, a disseminated protozoal infection, resident macrophages in liver, spleen, and bone marrow are preferentially targeted and support parasite replication. In the susceptible host, intracellular infection progresses until chemotherapy is given or, alternatively, a T-cell-dependent response emerges to induce acquired resistance (43). In experimental Leishmania donovani infection in susceptible mice, acquired resistance in the liver is initially regulated by multiple Th1- and Th2-cell-associated cytokines (11, 41, 43, 54, 57, 59). However, the mechanism is primarily driven to completion by Th1-type products, including interleukin 12 (IL-12) and IL-12-induced gamma interferon (IFN-), acting in concert with tumor necrosis factor (TNF) (11, 41-43, 54, 59). If unimpeded, the net result at infected liver foci is the assembly of epitheloid granulomas within which intracellular parasites are killed by IFN-- and TNF-activated macrophages (44).
This same inflammatory mechanism also supports the efficacy of conventional antileishmanial chemotherapy—T cells and endogenous IL-12 and IFN- are required for expression of the visceral leishmanicidal action of pentavalent antimony (Sb) in experimental infection (12, 40, 41). As judged by results with additional cytokine gene-disrupted mice, TNF and IL-4 also optimize the host response to Sb (2, 42). The role of IL-4, ordinarily considered a suppression-type cytokine, appears to reflect its less-well-appreciated capacity to foster Th1-cell development and help regulate initial IFN- secretion (2, 57).
Efforts to take advantage of the preceding immunopharmacology have focused on IL-12 and IFN- and on raising the level of T-cell reactivity at the time of Sb treatment. Approaches in visceral infection have included coadministration of Sb (i) with exogenous IL-12 or IFN- (37, 41) or (ii) with induction of endogenous IL-12 and/or IFN- achieved by T-cell costimulation (46, 63), transfer of sensitized dendritic cells (16), or injection of IL-12 to induce endogenous IFN- (41). These experimental approaches enhance Sb's initial efficacy and/or the durability of its effect.
A separate immunochemotherapeutic strategy—inhibition of cytokines which deactivate the Th1-cell mechanism—has thus far been directed at two endogenous Th2-cell-type products, IL-4 and IL-10. In wild-type (WT) BALB/c mice with cutaneous Leishmania major infection, anti-IL-4 monoclonal antibody (MAb) injections restored the durability of the response to Sb by allowing Th1-cell-type responses to emerge (49). In WT BALB/c mice infected with visceral L. donovani, IL-4 is also induced (30) but IL-10 plays the primary deactivating role (35, 45). In these animals, IL-10 receptor (IL-10R) blockade by anti-IL-10R MAb injection enhanced Th1-cell-type responses and granuloma maturation, induced IFN--dependent parasite killing in the liver, and synergistically increased Sb's leishmanicidal effect (45, 47).
Like IL-10 and IL-4, IL-13 and transforming growth factor (TGF-) are also generated in experimental and human visceral, as well as cutaneous, leishmaniasis (4-6, 14, 15, 17, 20, 24, 25, 28-30, 33, 35, 43, 44, 49, 58, 60). While TGF- and IL-13 induce certain immunoactivating effects (9, 18), both are also capable of deactivating Th1-cell and/or inflammatory macrophage responses and promoting intracellular Leishmania infection (5, 9, 10, 17, 24, 25, 52, 60). Therefore, in this study, we asked whether endogenous TGF- and IL-13 or perhaps IL-4 (39) also represent targets worth inhibiting in L. donovani-infected mice to strengthen host defense and/or enhance chemotherapy efficacy. Animals with established visceral infection were injected with antagonists of TGF-, IL-13, or IL-4 alone and in combination with Sb to determine if this immunotherapeutic approach can be extended beyond endogenous IL-10 (45, 47).
MATERIALS AND METHODS
Animals. Female BALB/c mice (each, 20 to 30 g) were purchased from Charles Rivers Laboratories (Wilmington, MA). IL-13R2–/– mice on a BALB/c back-ground were produced at Wyeth Research (Andover, MA) (62) and bred at Weill Medical College (New York, NY). These latter mice (females) were 6 to 11 weeks old when challenged with L. donovani. These studies were reviewed and approved by the Institutional Animal Care and Use Committee of Weill Medical College.
Visceral infection and tissue granuloma responses. Groups of three to five mice were injected via the tail vein with 1.5 x 107 hamster spleen-derived L. donovani amastigotes (1 Sudan strain) (45). Visceral infection was assessed microscopically by using Giemsa-stained liver imprints in which liver parasite burdens were measured by blinded counting of the number of amastigotes per 500 cell nuclei x liver weight in milligrams (Leishman-Donovan units [LDU]) (45). The histological response to infection was evaluated microscopically in liver sections stained with hematoxylin and eosin. The number of granulomas (infected Kupffer cells which attracted five or more mononuclear cells (45) was counted in 100 consecutive 40x fields and, at 100 parasitized foci, the granulomatous reaction was scored as none, developing, or mature (45). Mature granulomas consisted of a core of fused parasitized Kupffer cells surrounded by numerous mononuclear cells and showed epitheloid-type changes (44).
Anticytokine treatments. Cytokine antagonists were administered by intraperitoneal injection in 0.5 ml of saline starting 12 days after infection (day + 12). All mice were sacrificed 9 days later on day + 21. Day + 21 liver parasite burdens (LDU) were compared to day + 12 LDU to determine the percentage of parasite killing (45); differences between mean LDU values were analyzed by a two-tailed Student's t test.
For IL-10R blockade or IL-4 neutralization, the following were injected once on day + 12: (i) 0.5 mg of rat immunoglobulin G (IgG) or anti-IL-10R MAb (1B1.3A; provided by A. Beebe, DNAX Research Institute of Molecular and Cellular Biology, Palo Alto, CA) (45) or (ii) 5 mg of rat IgG or anti-IL-4 MAb (11.B.11; provided by C. Reynolds, Biologic Response Modifers Program, National Cancer Institute, Frederick, MD) (30). For IL-13 inhibition, 0.2 mg of soluble IL-13 receptor-2-IgG-Fc (IL-13R2-Fc) (Wyeth Research) or human IgG (Wyeth Research) was injected every second day as in previous studies (8) and was given on days + 12, + 14, + 16, and + 18. Soluble chimeric TGF- type II receptor-IgG-Fc (TGF-RII-Fc) (Biogen Idec, Cambridge, MA) was used to inhibit TGF- (34). Preliminary dose-response experiments (not shown) using a single injection on day + 12 of 1 to 10 mg/kg of body weight (25 to 250 μg) of TGF-RII-Fc indicated no effect on day + 21 for 1 mg/kg and maximal effects at 4 mg/kg (100 μg). The latter dose was used with infected mice and was given once on day + 12; controls received 4 mg/kg of mouse IgG2a (Biogen).
TGF- treatment. Starting one day after L. donovani challenge, mice were injected intraperitoneally thrice weekly for 4 weeks with 0.5 ml of saline alone or saline containing 5 μg of recombinant human TGF- (5). Cytokine was generously provided by S. Reed (Corixa Corporation, Seattle, WA).
Chemotherapy. To demonstrate the effect of combination treatment, cytokine antagonist-treated and control IgG-treated mice were injected once on day + 14 with suboptimal-dose pentavalent antimony (Sb) (50 mg/kg of sodium stibogluconate [Pentostam]; Wellcome Foundation, Ltd., London, United Kingdom) (45). Based upon prior results (45, 47), suboptimal anti-IL-10R (0.1 mg) was used in these experiments, whereas the other cytokine antagonists were used as described above. Optimal-dose Sb was tested in IL-13R2–/– and TGF--treated WT mice by injecting 500 mg/kg once on day + 14 (45).
TGF- and IL-13 expression in liver tissue and serum IFN- assay. TGF-1 and IL-13 mRNA expression was detected in liver lysates by semiquantitative reverse transcription-PCR (RT-PCR). The primers used for PCR were as follows: (i) for TGF-1, AGCCCGAAGCGGACTACTAT (sense) and TCCACATGTTGCTCCACACT (antisense); (ii) for IL-13, AGGAGCTGAGCAACATCACA (sense) and GTGGGCTACTTCGATTTTGG (antisense); and (iii) for hypoxanthine phosphoribosyltransferase, GTTGGATACAGGCCAGACTTTGTTG (sense) and GAGGGTAGGCTGGCCTATGGCT (antisense). The PCR products were analyzed by gel electrophoresis, quantified using Quantity One 4.4.1 (Bio-Rad, Hercules, CA), and normalized to hypoxanthine phosphoribosyltransferase for equal loading. Immunolocalization of intracellular TGF-1 protein was carried out as previously described (13) with liver sections and the polyclonal antibody LC 1-30-1 (6 μg/ml). Serum was assayed in duplicate at fourfold dilutions for IFN- activity by a murine IFN- enzyme-linked immunosorbent assay (BD-Pharmingen, set no. 555138) in which the lower limit of detection was 31 pg/ml.
RESULTS
IL-10R blockade in established infection. To provide a benchmark against which to compare the effects of antagonizing IL-4, TGF-, and IL-13, WT BALB/c mice were injected once with anti-IL-10R MAb on day + 12 after infection. As shown in Tables 1 and 2, anti-IL-10R induced liver parasite killing (63%) and at low doses enhanced the effect of suboptimal Sb, confirming the deactivating role of IL-10 in this model (45, 47). These effects were accompanied by elevated serum IFN- levels (Fig. 1) and a clear increase in liver granulomas scored as mature (68% ± 6% versus 18% ± 5% in control IgG-treated mice; P < 0.05, two experiments). Figure 2 illustrates the histological response on day + 21. Anti-IL-10R-induced parasite killing and synergy with Sb require IFN-; effects on granuloma assembly involve both IFN--dependent and -independent pathways (45).
Effect of anti-IL-4 MAb. In addition to IL-10 mRNA, L. donovani-infected WT BALB/c mice also initially express IL-4 mRNA in parasitized liver and/or spleen (28, 30, 34). However, injection of anti-IL-4 MAb on day + 12 produced no therapeutic action on day + 21 (Tables 1 and 2), did not affect granuloma maturation, and decreased serum IFN- levels (Fig. 1), although not signficantly (P > 0.05). Once-weekly injections of 5 mg of anti-IL-4 starting 1 day after L. donovani challenge also induced no antileishmanial activity on day + 21 or + 28 and did not enhance the efficacy of suboptimal Sb (50 mg/kg) given on day + 14. At the same time, this weekly anti-IL-4 treatment also did not promote parasite replication in WT mice or impair the response to Sb (50 or 500 mg/kg injected on day + 14) (two experiments; data not shown), effects reported with L. donovani-infected mice genetically deficient in IL-4 (57).
Detection of TGF- and effect of soluble TGF-RII-Fc. TGF-1 mRNA was detected by RT-PCR in livers of infected BALB/c mice (Fig. 3A); by day + 28, however, expression was not significantly different versus constitutive levels at day 0 in uninfected livers. Since TGF- mRNA expression may not correlate with protein production (29), tissue sections were stained for immunoreactive cytokine using an antibody which detects TGF-1 in active and latent form (13). In livers of uninfected mice, cell-associated reaction product was readily apparent and expressed within 75% of hepatocytes (Fig. 4A). In infected livers, results were clearly different: few parenchymal cells showed immunoreactive TGF-1 at either day + 14 (Fig. 4B) or day + 21 (not shown). In addition, within developing granulomas that encircle parasitized macrophages (Kupffer cells) (5, 52), few cells showed visible TGF- reaction product (Fig. 4B). Despite the preceding results, treatment with TGF-IIR-Fc, which interferes with cytokine-receptor binding and inhibits TGF- effects (34), altered the kinetics of L. donovani replication in WT mice. While a single injection of TGF-IIR-Fc on day + 12 primarily enabled inhibition of parasite replication, some parasite killing (14%) was also induced at day + 21 (Table 1). Administering an additional dose of TGF-IIR-Fc on either day + 14, +16, or + 18 did not further enhance the effect. Although endogenous TGF- appeared to actively promote infection, the antileishmanial effect of TGF-IIR-Fc was not sufficient to augment the action of low-dose Sb (Table 2) or to materially increase serum IFN- or granuloma maturation (Fig. 1 and 2).
Detection of IL-13 and response to soluble IL-13R2-Fc. L. donovani infection also stimulated IL-13 mRNA expression in livers of WT BALB/c mice (Fig. 3B), prompting the testing of IL-13R2-Fc, which inhibits IL-13-induced effects (8). Injections of IL-13R2-Fc on day + 12 or on days + 12 and + 14 produced no effect. However, four alternate-day treatments during days + 12 to + 18 clearly inhibited parasite replication (Table 1) and produced some enhancing effect on granuloma cellularity (Fig. 2F). Nevertheless, IL-13R2-Fc treatment did not promote Sb's efficacy (Table 2), alter serum IFN- (Fig. 1), or significantly increase mature granuloma numbers in the liver (not shown).
Effect of raising the levels of IL-13 or TGF-. The preceding results indicated a regulatory role for endogenous TGF- and IL-13, albeit limited, but none for IL-4. These findings were generated in the presence of counterbalancing and IL-12- and IFN--mediated Th1-type responses, which are also expressed in BALB/c mice by the second week of infection (30, 45). Thus, the observations did not exclude the possibility that IL-13 or TGF- might act in a more suppressive fashion under different conditions. For example, although anti-IL-4 has no effect in this L. donovani model (30), administration of IL-4 or manipulation that provokes endogenous IL-4 readily enhances visceral parasite replication in these same BALB/c mice (39). Therefore, to complete this analysis, we examined the consequences of raising IL-13 or TGF- levels rather than inhibiting their effects.
In the absence of the decoy function of IL-13R2, IL-13R2–/– mice show high IL-13 levels in the tissues including liver (62) and in this way are thought to phenotypically resemble IL-13 transgenic mice (26). The following results were observed with IL-13R2–/– versus WT BALB/c mice, respectively. (i) Serum IFN- was reduced at day + 14 (76 ± 23 versus 205 ± 34 pg/ml, six to seven mice per group; P > 0.05) and day + 21 (72 ± 18 versus 351 ± 53 pg/ml, six to eight mice per group; P < 0.05). (ii) Initial granuloma assembly and maturation were impaired (Fig. 5). (c) Liver parasite burdens were increased (Fig. 6A). These findings are consistent with a suppressive effect for IL-13. However, deficient tissue inflammation and susceptibility were not sustained in IL-13R2–/– mice, as after week 4, the granulomatous response evolved and liver burdens declined by 60% (Fig. 6A). IL-13Ra2–/– mice also demonstrated an intact response to optimal-dose Sb (500 mg/kg injected once on day + 14) with 88% killing of liver amastigotes by day + 21 versus 93% in WT controls; responses to suboptimal Sb (single injections of 50 or 100 mg/kg) were preserved as well (two experiments).
Raising the level of TGF- by injecting WT BALB/c mice with high-dose human TGF- also increased susceptibility but in a similarly transient fashion. Thrice-weekly treatment starting 1 day after infection with the same cytokine preparation that promoted L. braziliensis infection (5) increased liver parasite burdens on day + 14, but continued injections did not maintain the effect (Fig. 6B). In these same mice, exogenous TGF- did not impair either the liver granulomatous response (not shown) or affect the efficacy of optimal-dose (86% killing) or suboptimal-dose Sb given on day + 14 (two experiments).
DISCUSSION
In the spectrum of experimental leishmaniasis, IL-10, IL-4, IL-13, and TGF- are generally but not invariably (22, 31, 57) recognized for derailing Th1-cell-associated mechanisms and deactivating macrophages, thereby dampening inflammation but fostering progressive intracellular infection (17-19, 24, 25, 32, 35, 39, 45, 49, 51, 52, 60). In the L. donovani model, results with IL-10 transgenic and -deficient mice have already assigned such a role to IL-10 (35, 45). However, other suppressive-type cytokines, acting alone, with IL-10 or via crossregulation (4, 28, 29, 33, 39, 51, 55, 59, 60) may also promote visceral infection and therefore represent separate potential targets for therapeutic inhibition. Such inhibition, which can raise the level of Th1-cell reactivity and strengthen host defense in general (1, 24, 32, 35, 43, 45, 47, 49, 51, 52) can also specifically enhance chemotherapy efficacy. In addition to combining Sb or amphotericin B with targeting IL-10 in L. donovani infection (45, 47, 48), this anticytokine strategy has also been successfully directed at IL-4 in cutaneous L. major infection (anti-IL-4 MAb plus Sb) (49) and in systemic Candida albicans infection (antagonistic soluble IL-4 receptor plus antifungal agents) (7).
BALB/c mice express multiple deactivating cytokines in response to L. donovani (28, 30, 33), and our results indicate regulatory (suppressive) roles for both endogenous TGF- and IL-13. That endogenous IL-4 is expressed but does not exert a measurable effect in L. donovani-infected WT mice has also been made clear in previous studies (22, 27, 28). The effects of inhibiting endogenous TGF- or IL-13 in the midst of progressive infection were modest and limited primarily to induction of leishmanistatic activity. In contrast, anti-IL-10R treatment stimulated IFN- secretion and granuloma maturation, induced high-level parasite killing in the liver, and supported the efficacy of chemotherapy. These effects were not detected in mice treated with TGF-RII-Fc or IL-132R-Fc (or anti-IL-4), emphasizing in a comparative fashion IL-10's prominent handcuffing effect in visceral infection (35, 45, 47).
Since there may be organ-specific responses in the L. donovani model (11, 36), cytokine inhibition might produce different effects on infection in spleen or bone marrow. In addition, we have not yet examined how targeting IL-13 or TGF- enables inhibition of parasite replication, although in view of the intracellular location of L. donovani, enhancing effects on macrophage activation seem likely. Given our objective—a practical therapeutic strategy for use alone or in combination with chemotherapy in established infection (e.g., a single injection of anti-IL-10R (45, 47, 48)—these experiments were intended to determine effects of acute rather than chronic cytokine inhibition. Thus, it also remains possible that for TGF- and IL-13 (but not IL-4) inhibition, more time is required for the expression of additional antileishmanial effects. However, we tested chronic TGF- antagonism in one experiment by injecting TGF-RII-Fc (4 mg/kg) thrice weekly, starting 1 day after infection. In mice treated for 4 weeks, liver parasite replication was inhibited but still proceeded, granuloma formation was unaffected at weeks 2 and 4, and the effect of suboptimal Sb injected on day + 14 was not increased on day + 21 (four mice; data not shown).
The limited effects of inhibiting endogenous TGF- as well as IL-13 in WT mice might also reflect other factors. Both cytokines may preferentially target an auxillary (leishmanistatic) rather than a primary killing mechanism, and such a secondary mechanism might also not be involved in supporting Sb's leishmanicidal efficacy. For example, neither antagonist of TGF- or IL-13 provoked IFN-, the cytokine required for L. donovani killing, as well as the key endogenous cofactor in the host response to Sb (40, 43). IL-10-induced deactivation in this model may also be sufficient to mask competing, suppressive effects stimulated by IL-13 or TGF-; future experiments will test the effect of simultaneously inhibiting IL-10, TGF-, and/or IL-13.
Three additional observations are also worth comment. First, like IL-10 (32), endogenous IL-4 and IL-13 can also suppress Th1-cell-type mechanisms, indirectly and/or directly deactivate macrophages, and therefore foster intracellular Leishmania infection (9, 25, 35, 37, 47, 49, 50, 51, 53). However, neither IL-4 nor IL-13 plays a consistently suppressive role; their effects appear model and/or Leishmania species dependent (22, 23, 27, 30, 31, 49, 53, 56, 57). Adding to this complexity, IL-4 and IL-13 can also act to support host defenses. Results with L. donovani-infected IL-4–/– and IL-4R–/– mice indicate roles in initial Th1-cell development, IFN- regulation, and control of early L. donovani replication (27, 57), and for IL-4, in responsiveness to Sb treatment (2). In our experiments, these IL-4-associated effects were not apparent under the quite different conditions of treating WT mice once weekly with anti-IL-4 MAb starting 1 day after infection. In a separate setting, however, with WT BALB/c mice manipulated (immunized) to cross-react to L. donovani with a predominant Th2-type response, IL-4 readily emerges as a suppressive cofactor acting with IL-10 to impair granuloma assembly and induce the noncure phenotype (39).
Second, TGF-, which can produce upregulatory effects, is also fully capable of impairing Th1-cell responses and macrophage activation (10, 18). In experimental Leishmania infection, exogenous TGF- promotes cutaneous as well as visceral parasite replication (5, 60) (Fig. 6B) and, in endogenous form, stimulates initial progression or subsequent persistence of cutaneous infection (3, 24, 52). Inferential results also suggest that endogenous TGF- fosters the visceral replication of L. chagasi (14) and persistence of L. infantum (17); our findings with L. donovani-infected, TGF-RII-Fc-treated mice support such a role in vivo.
Nevertheless, in most but not all (28) models of visceral infection in WT mice, TGF- activity either does not increase during the initial period in which liver parasite replication is unrestrained (33, 61, 63) or increases but then decreases at the peak of hepatic infection (17). These results, reflected in in vitro and in vivo TGF- protein production (Fig. 4) (17, 61, 63) and in in vivo mRNA expression (Fig. 3A) (33), may help to explain the comparatively limited effect of TGF-RII-Fc treatment given during week 2 (Tables 1 and 2). However, TGF- activity can also reemerge or increase at a later stage of infection (28, 33, 61) and might take on other roles: curtailing the inflammatory response after liver infection is largely controlled, regulating conversion of residual liver infection to a chronic, persistent state (3, 17), or fostering the delayed but progressive infection in the spleen reported in some models of visceral infection (21, 33).
Finally and third, the intact response to Sb in the presence of excess IL-13 or TGF- adds to prior observations indicating that suppression-type cytokines do not impair the initial in vivo response to chemotherapy (45, 49). Optimal-dose Sb (500 mg/kg) is also fully active against L. donovani in the face of either sustained IL-10 in transgenic BALB/c mice (45) or raised levels of both IL-4 and IL-10 in heat-killed L. major-immunized BALB/c mice (39). In both of these latter noncuring groups of mice, as well as in IL-4 transgenic, IL-13R2–/–, and TGF--treated animals, an injection of 500 mg/kg of Sb on day + 14 is as active as in control mice, killing 90% of liver L. donovani by day + 21 (39, 45; the present report and unpublished data). Thus, although the leishmanicidal efficacy of Sb in the liver is dependent upon and can be amplified by the host Th1-cell-type response (12, 16, 37-41, 46, 47, 63), this particular IFN-- and IL-12-mediated Th1-cell action paradoxically escapes the deactivating effects of IL-10, IL-4, IL-13, or TGF-. Conversely, however, only inhibition of IL-10 synergistically enhanced the effect of Sb in this comparative analysis, strengthening the appeal of IL-10 as the appropriate cytokine target for therapeutic inhibition in experimental visceral infection.
ACKNOWLEDGMENTS
This work was supported by NIH grants AI 16369 (H.W.M.) and AI 45899 (X.M.).
Elaine Brooks and Christine Tsai provided expert technical assistance.
REFERENCES
1. Akhurst, R. J. 2002. TGF- antagonists: why suppress a tumor suppressor J. Clin. Investig. 109:1533-1536.
2. Alexander, J., K. C. Carter, N. Al-Fasi, A. Satoskar, and F. Brombacher. 2000. Endogenous IL-4 is necessary for effective drug therapy against visceral leishmaniasis. Eur. J. Immunol. 30:2935-2943.
3. Alexander, J. F. Brombacher, H. A. McGachy, A. N. McKenzie, W. Walker, and K. C. Carter. 2002. An essential role for IL-13 in maintaining a non-healing response following Leishmania mexicana infection. Eur. J. Immunol. 32:2923-2933.
4. Babaloo, Z., P. M. Kaye, and M. B. Eslami. 2001. Interleukin-13 in Iranian patients with visceral leishmaniaisis: relationship to other Th2 and Th1 cytokines. Trans. R. Soc. Trop. Med. Hyg. 95:85-88.
5. Barral-Netto, M., A. Barral, C. E. Brownell, Y. A. W. Skeiky, L. R. Ellingsworth, D. R. Twardzik, and S. G. Reed. 1992. Transforming growth factor- in leishmanial infection: a parasite escape mechanism. Science 257:545-548.
6. Bourreau, E., G. Prevot, R. Pradinaud, and P. Lainois. 2001. Interleukin (IL)-13 is the predominant Th2 cytokine in localized cutaneous leishmaniasis lesions and renders specific CD4+ T cells unresponsive to IL-12. J. Infect. Dis. 183:953-959.
7. Cenci, E., A. Mencacci, G. Del Sero, F. Bistoni, and L. Romani. 1997. Induction of protective Th1 responses to Candida albicans by antifungal therapy alone or in combination with an interleukin-4 antagonist. J. Infect. Dis. 176:217-226.
8. Chiaramonte, M. G., D. D. Donaldson, A. W. Cheever, and T. A. Wynn. 1999. An IL-13 inhibitor blocks the development of hepatic fibrosis during a T-helper type 2-dominated inflammatory response. J. Clin. Investig. 104:777-785.
9. deVries, J. E. 1998. The role of IL-13 and its receptor in allergy and inflammatory responses. J. Allergy Clin. Immunol. 102:165-169.
10. Ding, A., C. F. Nathan, J. Graycar, R. Derynck, D. J. Stuehr, and S. Srimal. 1990. Macrophage deactivating factor and transforming growth factors-1, -2 and -3 inhibit induction of macrophage nitrogen oxide synthesis by IFN-. J. Immunol. 145:940-944.
11. Engwerda, C. R., M. L. Murphy, S. E. Cotterell, S. C. Smelt, and P. M. Kaye. 1998. Neutralization of IL-12 demonstrates the existence of discrete organ-specific phases in the control of Leishmania donovani. Eur. J. Immunol. 28:669-680.
12. Escobar, P., V. Yardley, and S. L. Croft. 2001. Activities of hexadecylphosphocholine (miltefosine), AmBisome, and sodium stibogluconate (Pentostam) against Leishmania donovani in immunodeficient scid mice. Antimicrob. Agents Chemother. 45:1872-1875.
13. Flanders, K. C., C. D. Sullivan, M. Fujii, A. Sowers, M. A. Anzano, A. Arabshahi, C. Major, J. B. Mitchell, and A. B. Roberts. 2002. Mice lacking Smad3 are protected against cutaneous injury induced by ionizing radiation. Am. J. Pathol. 160:1057-1068.
14. Gantt, K. R., S. Schulz-Cherry, N. Rodriguez, S. M. B. Jeronimo, E. T. Nascimento, T. L. Goldman, T. J. Recker, M. A. Miller, and M. E. Wilson. 2003. Activation of TGF- by Leishmania chagasi: importance for parasite survival in macrophages. J. Immunol. 170:2613-2620.
15. Gassim, S., A. M. El-Hassan, E. A. G. Khalil, A. Ismail, A. M. Y. Kadarn, A. Kharazmi, and T. G. Theander. 1998. High levels of plasma IL-10 and expression of IL-10 by keratinocytes during visceral leishmaniasis predict subsequent development of post-kala-azar dermal leishmaniasis. Clin. Exp. Immunol. 111:64-69.
16. Ghosh, M., C. Pal, M. Ray, S. Maitra, L. Mandal, and S. Bandyopadhyay. 2003. Dendritic cell-based immunotherapy combined with antimony-based chemotherapy cures established murine visceral leishmaniasis. J. Immunol. 170:5625-5629.
17. Gomes-Pereira, S., O. R. Rodrigues, N. Rolao, P. D. Almeida, and G. M. Santos-Gomes. 2004. Hepatic cellular immune responses in mice with "cure" and "non-cure" phenotype to Leishmania infantum infection: importance of CD8+ T cells and TGF- production. FEMS Immun. Med. Microbiol. 41:59-68.
18. Gorelik, L., and R. A. Flavell. 2002. Transforming growth factor- in T cell biology. Nat. Rev. Immunol. 2:46-53.
19. Jones, D. E., L. U. Buxbaum, and P. Scott. 2000. IL-4-independent inhibition of IL-12 responsiveness during Leishmania amazonensis infection. J. Immunol. 165:364-372.
20. Karp, C. L., S. H. El-Safi, T. A. Wynn, M. M. H. Satti, A. N. Kordofani, F. A. Hashim, M. Hag-Ali, F. A. Neva, T. B. Nutman, and D. L. Sacks. 1993. In vivo cytokine profiles in patients with kala-azar. Marked elevation of both interleukin-10 and interferon-gamma. J. Clin. Investig. 91:1644-1648.
21. Kaye, P. M., M. Svensson, M. Ato, A. Maroof, R. Polley, S. Stager, S. Zubairi, and C. R. Engwerda. 2004. The immunopathology of experimental visceral leishmaniasis. Immunol. Rev. 201:239-253.
22. Kropf P., L. R. Schopf, C. L. Chung, D. Xu, F. Y. Liew, J. P. Sypek, and I. Muller. 1999. Expression of Th2 cytokines and the stable Th2 marker ST2L in the absence of IL-4 during Leishmania major infection. Eur. J. Immunol. 29:3621-3628.
23. Lehmann, J., K-H. Ensle, I. Lehmann, A. Emmendorfer, and M-L. Lohmann-Mattes. 2000. The capacity to produce IFN- rather than the presence of interleukin 4 determines the resistance and the degree of susceptibility to Leishmania donovani infection in mice. J. Interferon Cytokine Res. 20:63-77.
24. Li, J., C. A. Hunter, and J. P. Farrell. 1999. Anti-TGF- treatment promotes rapid healing of Leishmania major infection in mice by enhancing in vivo nitric oxide production. J. Immunol. 162:974-979.
25. Matthews, D. J., C. L. Emson, G. J. McKenzie, H. E. Jolin, J. M. Blackwell, and A. N. J. McKenzie. 2000. IL-13 is a susceptibility factor for Leishmania major infection. J. Immunol. 164:1458-1462.
26. McKenzie, A. N. J., and P. G. Fallon. 2003. Decoy receptors in the regulation of T helper cell type 2 responses. J. Exp. Med. 197:675-679.
27. McMahon-Pratt, D., and J. Alexander. 2004. Does the Leishmania major paradigm of pathogenesis and protection hold for New World cutaneous leishmaniases or the visceral disease Immunol. Rev. 201:206-224.
28. Melby, P. C., A. Tabares, B. I. Restrepo, A. E. Cardona, H. S. McGruff, and J. M. Teale. 2001. Leishmania donovani: evolution and architecture of the splenic cellular immune response related to control of infection. Exp. Parasitol. 99:17-25.
29. Melby, P. C., B. Chandrasekar, W. Zhao, and J. E. Coe. 2001. The hamster as a model of human visceral leishmaniasis: progressive disease and impaired generation of nitric oxide in the face of a prominent Th1-like cytokine response. J. Immunol. 166:1912-1920.
30. Miralles, G. D., M. Y. Stoeckle, D. F. McDermott, F. D. Finkelman, and H. W. Murray. 1994. Induction of Th1 and Th2 cell-associated cytokines in experimental visceral leishmaniasis. Infect. Immun. 62:1058-1063.
31. Mohrs, M., B. Ledermann, G. Kohler, A. Dorfmuller, A. Gessner., and F. Brombacher. 1999. Differences between IL-4- and IL-4-receptor -deficient mice in chronic leishmaniasis reveal a protective role for IL-13 receptor signaling. J. Immunol. 162:7302-7308.
32. Moore, K. W., R. de Waal Malefyt, R. L. Coffman, and A. O'Garra. 2001. Interleukin-10 and the interleukin-10 receptor. Annu. Rev. Immunol. 19:683-765.
33. Mukherjee, P., A. K. Ghosh, and A. C. Ghose. 2003. Infection pattern and immune response in the spleen and liver of BALB/c mice intracardially infected with Leishmania donovani amastigotes. Immunol. Lett. 86:131-138.
34. Muraoka, R. S., N. Dumont, C. A. Ritter, T. C. Dugger, D. M. Brantley, J. Chen, E. Easterly, L. R. Roebuck, S. Ryan, P. J. Gotwals, V. Koteliansky, and C. L. Arteaga. 2002. Blockade of TGF- inhibits mammary tumor cell viablity, migration, and metastases. J. Clin. Investig. 109:1551-1559.
35. Murphy, M. L., U. Wille, E. N. Villegas, C. A. Hunter, and J. P. Farrell. 2001. IL-10 mediates susceptibility to Leishmania donovani infection. Eur. J. Immunol. 31:2848-2856.
36. Murray, H. W., H. Masur, and J. S. Keithly. 1982. Cell-mediated immune response in experimental visceral leishmaniasis. I. Correlation between resistance to Leishmania donovani and lymphokine-generating capacity. J. Immunol. 129:344-350.
37. Murray, H. W., J. D. Berman, and S. D. Wright. 1988. Immunochemotherapy for intracellular Leishmania donovani infection: interferon-gamma plus pentavalent antimony. J. Infect. Dis. 157:973-978.
38. Murray, H. W., M. J. Oca, A, M. Granger, and R. D. Schreiber. 1989. Successful response to chemotherapy in experimental visceral leishmaniasis: requirement for T cells and effect of lymphokines. J. Clin. Investig. 83:1254-1259.
39. Murray, H. W., J. Hariprashad, and R. L. Coffman. 1997. Behavior of visceral Leishmania donovani in an experimentally-induced Th2 cell-associated response model. J. Exp. Med. 185:867-874.
40. Murray, H. W., and S. Delph-Etienne. 2000. Role of endogenous gamma interferon and macrophage microbicidal mechanisms in host response to chemotherapy in experimental visceral leishmaniasis. Infect. Immun. 68:288-293.
41. Murray, H. W., C. Montelibano, R. Peterson, J. P. Sypek. 2000. Interleukin 12 regulates the response to chemotherapy in experimental visceral leishmaniasis J. Infect. Dis. 182:1497-1503.
42. Murray, H. W., A. Jungbluth, E. Ritter, C. Montelibano, and M. W. Marino. 2000. Visceral leishmaniasis in mice devoid of tumor necrosis factor and response to treatment. Infect. Immun. 68:6289-6293.
43. Murray, H. W. 2001. Clinical and experimental advances in treatment in visceral leishmaniasis. Antimicrob. Agents Chemother. 45:2185-2197.
44. Murray, H. W. 2001. Tissue granuloma structure-function in experimental visceral leishmaniasis. Int. J. Exp. Pathol. 82:249-267.
45. Murray, H. W., C. M. Lu, S. Mauze, S. Freeman, A. L. Moreira, G. Kaplan, and R. L. Coffman. 2002. Interleukin-10 (IL-10) in experimental visceral leishmaniasis and IL-10 receptor blockade as immunotherapy. Infect. Immun. 70:6284-6293.
46. Murray, H. W., C. M. Lu, E. B. Brooks, R. E. Fichtl, J. L. DeVecchio, and F. P. Heinzel. 2003. Modulation of T-cell costimulation as immuno- or immunochemotherapy in experimental visceral leishmaniasis. Infect. Immun. 71:6453-6462.
47. Murray, H. W., A. L. Moreira, C. M. Lu, J. L. DeVecchio, M. Matsuhashi, X. Ma, and F. P. Heinzel. 2003. Determinants of response to interleukin 10 receptor blockade immunotherapy in experimental visceral leishmaniasis. J. Infect. Dis. 188:458-464.
48. Murray, H. W., E. B. Brooks, J. L. DeVecchio, and F. P. Heinzel. 2003. Immunoenhancement combined with amphotericin B as treatment in experimental visceral leishmaniasis. Antimicrob. Agents Chemother. 47:2513-2517.
49. Nabors, G. S. 1997. Modulating ongoing Th2-cell responses in experimental leishmaniasis. Parasitol. Today 13:76-79.
50. Noben-Trauth, N., R. Lira, H. Nagase, W. E. Paul, and D. L. Sacks. 2003. The relative contrtibution of IL-4 receptor signaling and IL-10 to susceptibility to Leishmania major. J. Immunol. 170:5152-5158.
51. Powrie, F., S. Menon, and R. L. Coffman. 1993. IL-4 and IL-10 synergize to inhibit cell-mediated immunity in vivo. Eur. J. Immunol. 23:2223-2229.
52. Reed, S. G. 1999. TGF- in infections and infectious diseases. Microbes Infect. 1:1313-1325.
53. Reiner, S. L., and R. M. Locksley. 1995. The regulation of immunity to Leishmania major. Annu. Rev. Immunol. 13:151-177.
54. Satoskar, A. R., S. Rodig, S. R. Telford, A. A. Satoskar, S. K. Ghosh, F. von Lichtenberg, and J. R. David. 2000. IL-12 gene-deficient C57BL/6 mice are susceptible to Leishmania donovani but have diminshed hepatic pathology. Eur. J. Immunol. 30:834-839.
55. Schmidt-Weber, C. B., and K. Blaser. 2004. Regulation and role of transforming growth factor- in immune tolerance induction and inflammation. Curr. Opin. Immunol. 16:709-716.
56. Sosa, M. R., L. E. Rosas, A. N. J. McKenzie, and A. R. Satoskar. 2001. IL-13 gene-deficient mice are susceptible to cutaneous Leishmania mexicana infection. Eur. J. Immunol. 31:3255-3260.
57. Stager, S., J. Alexander, K. C. Carter, F. Brombacher, and P. M. Kaye. 2003. Both interleukin-4 (IL-4) and IL-4 receptor signaling contribute to the development of hepatic granulomas with optimal antileishmanial activity. Infect. Immun. 71:4804-4807.
58. Sundar, S., S. G. Reed, S. Sharma, A. Mehrota, and H. W. Murray. 1997. Circulating Th1 cell- and Th2 cell-associated cytokines in Indian patients with visceral leishmaniasis. Am. J. Trop. Med. Hyg. 56:522-525.
59. Tumang, M. C. T., C. Keogh, L. L. Moldawer, D. C. Helfgott, R. Teitelbaum, J. Hariprashad, and H. W. Murray. 1994. Role and effect of TNF- in experimental visceral leishmaniasis. J. Immunol. 153:768-775.
60. Wilson, M. E., B. M. Young, B. L. Davidson, K. A. Mente, and S. E. McGowan. 1998. The importance of TGF- in murine visceral leishmaniasis. J. Immunol. 161:6148-6155.
61. Wilson, M. E., T. J. Recker, N. E. Rodriguez, B. M. Young, K. K. Burnell, J. A. Streit, and J. N. Kline. 2002. The TGF- response to Leishmania chagasi in the absence of IL-12. Eur. J. Immunol. 32:3556-3565.
62. Wood, N., M. J. Whitters, B. A. Jacobson, J. Witek, J. P. Sypek, M. Kasaian, M. J. Eppihimer, M. Unger, T. Tanaka, S. J. Goldman, M. Collins, D. D. Donaldson, and M. J. Grusby. 2003. Enhanced interleukin (IL)-13 responses in mice lacking IL-13 receptor 2. J. Exp. Med. 197:703-709.
63. Zubairi, S., S. L. Sanos, S. Hill, and P. M. Kaye. 2004. Immunotherapy with OX40L-Fc or anti-CTLA-4 enhances local tissue responses and killing of Leishmania donovani. Eur. J. Immunol. 34:1-8.(Henry W. Murray, Kathleen)
寰俊鏂囩珷
鍏虫敞鐧炬媷
璇勮鍑犲彞
鎼滅储鏇村
鎺ㄥ瓨缁欐湅鍙�
鍔犲叆鏀惰棌
|